si:dkey-44g23.9

Ensembl ID:
ENSDARG00000093878
ZFIN ID:
ZDB-GENE-050208-636
Description:
Novel protein similar to vertebrate pim-1 oncogene (PIM1) [Source:UniProtKB/TrEMBL;Acc:Q1MT58]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43865 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146806 Nonsense 225 272 5 6
Genomic Location (Zv9):
Chromosome 22 (position 27416506)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26931951
GRCz11 22 26794403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCTGTGGCCACTTCCCTACACACTATGACATCTTTCAACTGAAATA[C/A]AAGCGGTATACTTATATTCAACCCAGCCGGTCAAAAGGTAAGACACGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link