wee1

Ensembl ID:
ENSDARG00000093864
ZFIN ID:
ZDB-GENE-030131-5268
Description:
wee1-like protein kinase [Source:RefSeq peptide;Acc:NP_001005770]
Human Orthologue:
WEE1
Human Description:
WEE1 homolog (S. pombe) [Source:HGNC Symbol;Acc:12761]
Mouse Orthologue:
Wee1
Mouse Description:
WEE 1 homolog 1 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:103075]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14668 Nonsense Available for shipment Available now
sa43073 Nonsense Mutation detected in F1 DNA During 2018
sa1651 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa14668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122102 Nonsense 282 612 4 10
Genomic Location (Zv9):
Chromosome 18 (position 16580899)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16932665
GRCz11 18 16921731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYGAGTTGGAGAAGATTGGCTCTGGACAGTTTGGTTCTGTTTTTAARTG[C/A]GTCAAGAGGTTGGACGGCTGTATTTACGCCATCAAACGTTCCAAAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122102 Nonsense 493 612 8 10
Genomic Location (Zv9):
Chromosome 18 (position 16579890)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16931656
GRCz11 18 16920722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGCAGAGCCTCTTCCTACCAATGGAGACAAGTGGCACAAAATCCGA[C/T]AGGGCATTCTGCCCCATATCCCTCAAGTGCTTTCTCAGGAATTTTTAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1651
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122102 Nonsense 601 612 10 10
Genomic Location (Zv9):
Chromosome 18 (position 16578650)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16930416
GRCz11 18 16919482
KASP Assay ID:
554-1591.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACACGTTCCACAATCCAGTCCAGCTCCAGAGCTTCCCGACTCATCGGA[A/T]AAAAGATGAACCGCTCGGTTAGCCTCACCATTTACTGAACTGAACTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link