si:dkey-248f6.3

Ensembl ID:
ENSDARG00000093863
ZFIN ID:
ZDB-GENE-091112-6

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29542 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146283 Nonsense 561 583 9 10
Genomic Location (Zv9):
Chromosome 21 (position 11783136)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13484310
GRCz11 21 13581039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATTGCCTGGACCTGATTTCCCAGTGTTTGGTCCGCAATCCAGAGAAG[C/T]GACTGCAGTTACATCAGTTAGAAGAGCACCGGTGGTTCAATCCAACGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link