
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
CD22 (32 of 32)
- Ensembl ID:
- ENSDARG00000093845
- Description:
- CD22 molecule [Source:HGNC Symbol;Acc:1643]
- Human Orthologue:
- CD22
- Human Description:
- CD22 molecule [Source:HGNC Symbol;Acc:1643]
- Mouse Orthologue:
- Cd22
- Mouse Description:
- CD22 antigen Gene [Source:MGI Symbol;Acc:MGI:88322]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31245 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31245
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000134129 | Essential Splice Site | 17 | 416 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 1 (position 57542977)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 56278081 GRCz11 1 56993168 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCAGTGTAACTGATAAACTATATTTTAGTCATGGCTATCTCTGTGTTTC[A/T]GGGGTTTCTGCTGCTGATTGGGGTGTGAATTACAGTCCTTTACAAATCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: