zgc:136461

Ensembl ID:
ENSDARG00000093844
ZFIN ID:
ZDB-GENE-060519-7
Description:
hypothetical protein LOC562139 [Source:RefSeq peptide;Acc:NP_001075159]
Human Orthologues:
CTRB1, CTRB2
Human Descriptions:
chymotrypsinogen B1 [Source:HGNC Symbol;Acc:2521]
chymotrypsinogen B2 [Source:HGNC Symbol;Acc:2522]
Mouse Orthologue:
Ctrb1
Mouse Description:
chymotrypsinogen B1 Gene [Source:MGI Symbol;Acc:MGI:88559]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11393 Nonsense Available for shipment Available now
sa25368 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34120 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022139 Nonsense 48 263 2 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 36522967)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34796810
GRCz11 7 35068287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCCAGGATTGTRAACGGTGAGGAGGCTGTCCCTCATTCCTGGCCCTGG[C/T]AGGTGTCTCTGCAGRTATGAAYAGACAGATTTTCACTTACAGATGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022139 Essential Splice Site 53 263 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 36523064)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34796907
GRCz11 7 35068384
KASP Assay ID:
554-7835.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAGGATAGGCAACTGTGAATAAAAAAATTGATCTGATGTTTAATGTA[A/G]GGACTCCACCGGCTTCCACTTCTGCGGAGGCTCCCTGATCAACGAGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022139 Essential Splice Site 166 263 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 36524035)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34797878
GRCz11 7 35069355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATTTTCTTTCGTGCAAGCTTTCAAACACATTTTTGTAACTTTTTTTT[A/T]GCTCCTGATACCCCTGCCCTGCTCCAGCAGGCCGCTCTGCCTCTGCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link