
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
itln2
- Ensembl ID:
- ENSDARG00000093796
- ZFIN ID:
- ZDB-GENE-050411-58
- Human Orthologues:
- ITLN1, ITLN2
- Human Descriptions:
- intelectin 1 (galactofuranose binding) [Source:HGNC Symbol;Acc:18259]
- intelectin 2 [Source:HGNC Symbol;Acc:20599]
- Mouse Orthologues:
- Gm9765, Itln1
- Mouse Descriptions:
- intelectin 1 (galactofuranose binding) Gene [Source:MGI Symbol;Acc:MGI:1333831]
- predicted gene 9765 Gene [Source:MGI Symbol;Acc:MGI:3642721]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38623 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38623
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000073554 | Essential Splice Site | 44 | 305 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 34472501)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 32866841 GRCz11 7 33137991 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTGCTCGAAGCTGCAAAGAAATCCGTGACAAGTACTATGTTTATGAGG[G/A]TATGATCTCATTCTATATCTTTTATTTGTAATGTTAGACAGCATCTGCAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
- Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: