si:rp71-79p20.2

Ensembl ID:
ENSDARG00000093794
ZFIN ID:
ZDB-GENE-030616-83
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q8AW84]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24274 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143675 Nonsense 25 141 1 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 14703018)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14834951
GRCz11 23 14591028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGCAGCGAGCCGGCGACTGCACGCCCGAGGGGGGCTGCACCGGCCAG[C/T]GAGAGCCTGTCACTGGAAAAGCGTTCAAAACAAACACGCAGCTGCACGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link