
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-23o4.5
- Ensembl ID:
- ENSDARG00000093784
- ZFIN ID:
- ZDB-GENE-100922-271
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36215 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa8599 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36215
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000144852 | Nonsense | 110 | 220 | 5 | 7 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 40786646)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 38171446 GRCz11 16 38121478 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGTCATCTTGGCACCAGGAGGAGGTGGACTGGGCACTGTGGCTCTGTCA[C/T]AGGTTCTCCTGCCTGGAACATCTATTGCCAATGTTACCAACAGTCAGCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8599
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000144852 | Nonsense | 148 | 220 | 6 | 7 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 40786859)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 38171659 GRCz11 16 38121691 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAGGGTCTTCCTGTCCAGAATATCCAGCCTGGCCAGGGTCCAATGAGTT[T/G]AGTGCTGAATGTYCAACAAGGCCAAACTGTTCGACCGATTACTCTACTCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: