si:dkeyp-23f6.2

Ensembl ID:
ENSDARG00000093767
ZFIN ID:
ZDB-GENE-091117-26
Mouse Orthologue:
Cacna1b
Mouse Description:
calcium channel, voltage-dependent, N type, alpha 1B subunit Gene [Source:MGI Symbol;Acc:MGI:88296]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37258 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143605 Essential Splice Site 281 387 7 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12638323)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14339497
GRCz11 21 14436226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCCTTTCTGACCCTCTTCACTGTGTCTACAGGAGAGGGCTGGCCACT[G/T]TAAGTTCACTTCATCTATCACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link