wu:fe11b02

Ensembl ID:
ENSDARG00000093756
ZFIN IDs:
ZDB-GENE-030131-4921, ZDB-GENE-050522-106, ZDB-GENE-071004-32, ZDB-GENE-071004-46
Description:
hypothetical protein LOC554097 [Source:RefSeq peptide;Acc:NP_001019569]
Human Orthologues:
HIST1H2BA, HIST2H2BE
Human Descriptions:
histone cluster 1, H2ba [Source:HGNC Symbol;Acc:18730]
histone cluster 2, H2be [Source:HGNC Symbol;Acc:4760]
Mouse Orthologue:
Hist1h2ba
Mouse Description:
histone cluster 1, H2ba Gene [Source:MGI Symbol;Acc:MGI:2448375]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40831 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145370 Nonsense 33 132 1 2
Genomic Location (Zv9):
Chromosome 7 (position 6804898)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5839236
GRCz11 7 5960883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTAACTAAAACCGCCGGCAAAGGAGGAAAGAAGCGCAAGAGGACCAGG[A/T]AGGAGAGCTATGCAATCTACGTGTACAAAGTGCTGAAGCAGGTCCATCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link