zgc:174224

Ensembl ID:
ENSDARG00000093672
ZFIN IDs:
ZDB-GENE-050420-148, ZDB-GENE-071004-118, ZDB-GENE-071004-118
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZB2]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24053 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133611   None 109 None 3
ENSDART00000147345 Nonsense 120 122 3 3
Genomic Location (Zv9):
Chromosome 22 (position 1636787)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2377877
GRCz11 22 2394143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCATCGCTGCACTGATTGTGGGAAGAGTTTCACGGATTCATCTTCCTTA[C/T]AAAAACACCGAAAAAACAATCACAGTGAGTAGAGCGTCTACAGATCCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link