ugt5a2

Ensembl ID:
ENSDARG00000093640
ZFIN IDs:
ZDB-GENE-030131-1097, ZDB-GENE-061103-373
Description:
UDP glucuronosyltransferase 5 family, polypeptide A2 [Source:RefSeq peptide;Acc:NP_001070191]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44334 Nonsense Mutation detected in F1 DNA During 2018
sa32540 Nonsense Available for shipment Available now
sa45023 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110774 Nonsense 14 524 2 2
Genomic Location (Zv9):
Chromosome 25 (position 30392837)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28960198
GRCz11 25 29403205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCAAAGATGCATTCCCACATCCATCTCGGATTGTTCCTTCTGTTATG[T/A]GTCCTTTCAAGATCTTACGCTGGTAAACTTCTCGTGGTTCCTGTGGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110774 Nonsense 201 524 2 2
Genomic Location (Zv9):
Chromosome 25 (position 30392278)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28959639
GRCz11 25 29402646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCATCTCCTCTCTCATATGTACCTGTTTCAGGCTTACAACTAACGGAC[A/T]AGATGACATTCAGTCAGAGAGTCATGAACATGATGACATATATAATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110774 Nonsense 245 524 2 2
Genomic Location (Zv9):
Chromosome 25 (position 30392145)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28959506
GRCz11 25 29402513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCAAGAGCTCACCCAGAAATATTTTGGCCCCAATGTTAATTTCTTCT[C/A]GCTTCTTCAGGATGCAGACCTCTGGCTCATGAGAAACGATTTTACTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link