si:dkey-25o1.6

Ensembl ID:
ENSDARG00000093608
ZFIN ID:
ZDB-GENE-091204-276
Description:
hypothetical protein LOC563952 [Source:RefSeq peptide;Acc:NP_001108526]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7522 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145829 Missense 8 96 1 4

The following transcripts of ENSDARG00000093608 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28270206)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27320793
GRCz11 24 27399952
KASP Assay ID:
554-4338.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGATACCAGAAGTGAAACTGTGACAATGAARACACAAAAGATCTTCA[T/A]GAGGAGTTTGGYTGTTGCACTTACTGCATCAGTGATCTGGACTGTTACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link