Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-225b11.4
- Ensembl ID:
- ENSDARG00000093563
- ZFIN ID:
- ZDB-GENE-060526-114
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BGW1]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa8906 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8906
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000137603 | Nonsense | 224 | 344 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 5 (position 22670674)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 20383546 GRCz11 5 20887346 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCRAATGTGTTTGCAGAGCCATCTGTGATCTCAGAGTGTCTGSTGCCATA[C/A]CTTTTGCGTCTGGTTAAACATTACCCACAATCCTCCAGCCTCGCAGAGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
