si:dkey-253d23.10

Ensembl ID:
ENSDARG00000093529
ZFIN ID:
ZDB-GENE-050208-490
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LWP6]
Human Orthologues:
NLRP12, RNH1
Human Descriptions:
NLR family, pyrin domain containing 12 [Source:HGNC Symbol;Acc:22938]
ribonuclease/angiogenin inhibitor 1 [Source:HGNC Symbol;Acc:10074]
Mouse Orthologue:
Rnh1
Mouse Description:
ribonuclease/angiogenin inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1195456]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3172 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135657 Essential Splice Site 58 115 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 10064900)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9925068
GRCz11 22 9954750
KASP Assay ID:
554-2870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACATATCAACATGTATCTCAGTCATTGTCTTTTCGCTTTCTATCTTC[A/T]GACTTTGTAAATGCAGTATTACAGAGGAACAGTGTGTGATCCTGACTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link