si:ch211-207i1.3

Ensembl ID:
ENSDARG00000093468
ZFIN ID:
ZDB-GENE-041014-81
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHJ4]
Human Orthologue:
SYNE2
Human Description:
spectrin repeat containing, nuclear envelope 2 [Source:HGNC Symbol;Acc:17084]
Mouse Orthologue:
Syne2
Mouse Description:
synaptic nuclear envelope 2 Gene [Source:MGI Symbol;Acc:MGI:2449316]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45694 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145807 Nonsense 15 147 1 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21868249)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21896416
GRCz11 20 21796089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGAGAGGGGCGTTCTACTGGACATTGATGACGTTCACTTGCTTTTA[C/T]AAGGTTAGTCTTAACTTTCAGAAAATTATCGGTCTTTGTTTATTTAGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link