taar10d

Ensembl ID:
ENSDARG00000093466
ZFIN ID:
ZDB-GENE-041014-97
Description:
trace amine-associated receptor 10d [Source:RefSeq peptide;Acc:NP_001076371]
Human Orthologue:
TAAR1
Human Description:
trace amine associated receptor 1 [Source:HGNC Symbol;Acc:17734]
Mouse Orthologue:
Taar1
Mouse Description:
trace amine-associated receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2148258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29452 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137790 Nonsense 327 336 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46179943)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46242030
GRCz11 20 46145750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTGGTTCAGACATGCTTTCAGAGTCATTCTGTCCAAAGCAATATTT[C/T]AGACAAATTCTTCAAGAACTGTGCTGTTGTAAAATTAAACAGATAAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link