
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-175l6.1
- Ensembl ID:
- ENSDARG00000093464
- ZFIN ID:
- ZDB-GENE-060503-861
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MT13]
- Human Orthologue:
- TRIM35
- Human Description:
- tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
- Mouse Orthologue:
- Trim35
- Mouse Description:
- tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45130 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11620 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa45130
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000146637 | Nonsense | 34 | 319 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 3 (position 8078913)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 8126689 GRCz11 3 8012529 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGTGTTTTGACTCAGATTATTAAATGTGTCTGTGATTTACTTTCAGTTT[C/T]AAGCTGATCACACAGAGCGTCAGATTAAACATGAGTTTGAGAAGCTTCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11620
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000146637 | Nonsense | 149 | 319 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 3 (position 8079409)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 8126193 GRCz11 3 8012033 - KASP Assay ID:
- 2259-3046.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGATTCATGTGTGKCGCTACTTGGGGAACCTGCCGTTCAGAGTCTGGAAG[A/T]AGATGCAGGACATCGTCCACTACAGTAAGAGTCCCTACAACATCTCTACT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: