si:dkey-27a13.1

Ensembl ID:
ENSDARG00000093421
ZFIN IDs:
ZDB-GENE-041111-169, ZDB-GENE-060503-351
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQE6]
Human Orthologues:
COL13A1, COL23A1, COL25A1
Human Descriptions:
collagen, type XIII, alpha 1 [Source:HGNC Symbol;Acc:2190]
collagen, type XXIII, alpha 1 [Source:HGNC Symbol;Acc:22990]
collagen, type XXV, alpha 1 [Source:HGNC Symbol;Acc:18603]
Mouse Orthologues:
Col13a1, Col23a1, Col25a1
Mouse Descriptions:
collagen, type XIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1277201]
collagen, type XXIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2653243]
collagen, type XXV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1924268]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8492 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23577 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136775 Essential Splice Site 99 151 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40084696)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38948679
GRCz11 19 38535799
KASP Assay ID:
2261-3594.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAAGGGAGAGAAGGGAGATCCTGGTGTTGGGCAGAAAGGAGAGCAGG[T/C]GAATGTGATGGACTGATTTCTCATTGACATCCAGCACACATCATTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136775 Essential Splice Site 118 151 None 7
Genomic Location (Zv9):
Chromosome 19 (position 40022843)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38886826
GRCz11 19 38473946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCAACATTCAGTCATCTTTAAAGCAAACGGCATCTCTGATCCTCTGC[T/A]GCGTCAGCCAGTCTGATGCTTTTACACTTTGCACTTTATCCTCTCATTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link