zgc:111986

Ensembl ID:
ENSDARG00000093406
ZFIN ID:
ZDB-GENE-050522-304
Description:
hypothetical protein LOC553664 [Source:RefSeq peptide;Acc:NP_001018473]
Human Orthologue:
C6orf62
Human Description:
chromosome 6 open reading frame 62 [Source:HGNC Symbol;Acc:20998]
Mouse Orthologue:
BC005537
Mouse Description:
cDNA sequence BC005537 Gene [Source:MGI Symbol;Acc:MGI:2441726]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17934 Nonsense Available for shipment Available now
sa43306 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052183 Nonsense 12 230 1 5
Genomic Location (Zv9):
Chromosome 19 (position 32828352)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31995641
GRCz11 19 31582954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTACTGTCCGTAAAAATGGRTGACCCAAATTCTCGACGGAATCAAACA[C/T]GAAACCGACTCCGTGCCCAGCTACGGAAGAAACGGGAATCTCTGGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052183 Essential Splice Site 43 230 1 5
Genomic Location (Zv9):
Chromosome 19 (position 32828256)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31995545
GRCz11 19 31582858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATCAGTTTGACTTCAAGATCTACATTGCCTTTGTATTTAAGGAAAAG[G/A]TATGTACATCTAAACGATATGAATTTGTTTGGAAAATGGACTGGCGTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link