Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-227e10.7
- Ensembl ID:
- ENSDARG00000093319
- ZFIN ID:
- ZDB-GENE-050419-53
- Description:
- hypothetical protein LOC100008037 [Source:RefSeq peptide;Acc:NP_001121772]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa25285 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25285
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000135753 | Nonsense | 4 | 96 | 1 | 3 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 4 (position 45258260)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 52556551 GRCz11 4 54486753 - KASP Assay ID:
- 554-7503.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAAGCTCTGCTAATGTCTGCATTGGTGTTTAAGCTGCAGTATGGCAGAG[G/T]AGCGAGTAAAGGATTCTCTCTCAGAGAAACACAGGTATTGACTCTGTTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
