zgc:65788

Ensembl ID:
ENSDARG00000093193
ZFIN ID:
ZDB-GENE-030131-1140
Description:
hypothetical protein LOC322420 [Source:RefSeq peptide;Acc:NP_955897]
Human Orthologue:
OVGP1
Human Description:
oviductal glycoprotein 1, 120kDa [Source:HGNC Symbol;Acc:8524]
Mouse Orthologue:
Ovgp1
Mouse Description:
oviductal glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:106661]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43942 Nonsense Mutation detected in F1 DNA During 2018
e43 Nonsense Confirmed mutation in F2 line Unknown
sa16650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012571 Nonsense 3 480 1 11
ENSDART00000128268 Nonsense 21 498 2 12
ENSDART00000145200 Nonsense 3 171 1 6
Genomic Location (Zv9):
Chromosome 23 (position 18152018)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18054957
GRCz11 23 17981300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAGCACACTGATACTCTTGGCTGATACAACCATCGCTTGAAGATGAGC[A/T]GATTCATTTTTATAGCCGGTGAGTAATTGTTGATCTTACATAACATACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
e43
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012571 Nonsense 30 480 3 11
ENSDART00000128268 Nonsense 48 498 4 12
ENSDART00000145200 Nonsense 30 171 3 6
Genomic Location (Zv9):
Chromosome 23 (position 18153378)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18056317
GRCz11 23 17982660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGTTCCAGGATTGGCGTCCCAACTTGTATGTTACTTCACCAACTG[G/A]TCTCAGTACAGACCTGATGTTGGCAAGTACATGCCATCTAATGTGGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012571 Nonsense 321 480 9 11
ENSDART00000128268 Nonsense 339 498 10 12
ENSDART00000145200   None 171 None 6
Genomic Location (Zv9):
Chromosome 23 (position 18161322)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18064261
GRCz11 23 17990604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCTGTACTTTTCTAAAACAAGCCACTGTGCAACAGATAGTTGATCAG[A/T]AAGTTCCTTATGCAACAAAAGGACAGGAGTGGGTGGGATTTGATAACATR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link