
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:65788
- Ensembl ID:
- ENSDARG00000093193
- ZFIN ID:
- ZDB-GENE-030131-1140
- Description:
- hypothetical protein LOC322420 [Source:RefSeq peptide;Acc:NP_955897]
- Human Orthologue:
- OVGP1
- Human Description:
- oviductal glycoprotein 1, 120kDa [Source:HGNC Symbol;Acc:8524]
- Mouse Orthologue:
- Ovgp1
- Mouse Description:
- oviductal glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:106661]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43942 | Nonsense | Mutation detected in F1 DNA | During 2018 |
e43 | Nonsense | Confirmed mutation in F2 line | Unknown |
sa16650 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43942
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012571 | Nonsense | 3 | 480 | 1 | 11 |
ENSDART00000128268 | Nonsense | 21 | 498 | 2 | 12 |
ENSDART00000145200 | Nonsense | 3 | 171 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 23 (position 18152018)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 18054957 GRCz11 23 17981300 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTAGCACACTGATACTCTTGGCTGATACAACCATCGCTTGAAGATGAGC[A/T]GATTCATTTTTATAGCCGGTGAGTAATTGTTGATCTTACATAACATACTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- e43
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Unknown
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012571 | Nonsense | 30 | 480 | 3 | 11 |
ENSDART00000128268 | Nonsense | 48 | 498 | 4 | 12 |
ENSDART00000145200 | Nonsense | 30 | 171 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 23 (position 18153378)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 18056317 GRCz11 23 17982660 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGTTTGTTCCAGGATTGGCGTCCCAACTTGTATGTTACTTCACCAACTG[G/A]TCTCAGTACAGACCTGATGTTGGCAAGTACATGCCATCTAATGTGGATCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16650
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012571 | Nonsense | 321 | 480 | 9 | 11 |
ENSDART00000128268 | Nonsense | 339 | 498 | 10 | 12 |
ENSDART00000145200 | None | 171 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 23 (position 18161322)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 18064261 GRCz11 23 17990604 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGATCTGTACTTTTCTAAAACAAGCCACTGTGCAACAGATAGTTGATCAG[A/T]AAGTTCCTTATGCAACAAAAGGACAGGAGTGGGTGGGATTTGATAACATR
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: