
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-198m1.1
- Ensembl ID:
- ENSDARG00000093192
- ZFIN ID:
- ZDB-GENE-091204-181
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa26036 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa26036
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000140330 | Nonsense | 20 | 163 | 1 | 3 |
ENSDART00000143711 | Nonsense | 20 | 29 | 1 | 3 |
The following transcripts of ENSDARG00000093192 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 18758506)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18786868 GRCz11 3 18936608 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGGAGTATGATGACGCCATCGTTATTTTAATTACACCTGAAATGGCTT[C/A]ACCCTCTTGTCAGGTAGAAGGTAAGAGCGCCCAATATTGTTTTGAAATAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: