
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:77118
- Ensembl ID:
- ENSDARG00000093176
- ZFIN ID:
- ZDB-GENE-040426-2211
- Description:
- hypothetical protein LOC405845 [Source:RefSeq peptide;Acc:NP_998074]
- Human Orthologue:
- PPT2
- Human Description:
- palmitoyl-protein thioesterase 2 [Source:HGNC Symbol;Acc:9326]
- Mouse Orthologue:
- Ppt2
- Mouse Description:
- palmitoyl-protein thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:1860075]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7294 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7294
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000007636 | 162 | 291 | 5 | 9 | |
ENSDART00000099642 | Essential Splice Site | 91 | 105 | None | 10 |
- Genomic Location (Zv9):
- Chromosome 15 (position 34414712)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 35260488 GRCz11 15 35118457 - KASP Assay ID:
- 554-4529.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCYRAGTCCTCACTGCACAATGTTTGTTATACTGAACTTGGACAAAAAAC[C/A]TCCTTCTGCAGCTACTGGAATGGTAAGATGTGCTACTTTCATGCATCAGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Pulmonary function: Meta-analyses of genome-wide association studies identify multiple loci associated with pulmonary function. (View Study)
- Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: