si:dkey-235d18.5

Ensembl ID:
ENSDARG00000093097
ZFIN ID:
ZDB-GENE-041014-243
Description:
Novel protein similar to vertebrate fibrillin [Source:UniProtKB/TrEMBL;Acc:Q5SPD2]
Human Orthologues:
FBLN1, FBLN2
Human Descriptions:
fibulin 1 [Source:HGNC Symbol;Acc:3600]
fibulin 2 [Source:HGNC Symbol;Acc:3601]
Mouse Orthologues:
Fbln1, Fbln2
Mouse Descriptions:
fibulin 1 Gene [Source:MGI Symbol;Acc:MGI:95487]
fibulin 2 Gene [Source:MGI Symbol;Acc:MGI:95488]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37178 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132512 Nonsense 161 213 4 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 52938572)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52791419
GRCz11 20 52597035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGTCGAGGAGACTGTGAAAACACACTAGGCAGTTACAGGTGTGTGTGT[C/T]AGCGTGGTTACCGTGGCAATGGCACACACTGCACAGGTGAGTAACACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link