
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-21e7.2
- Ensembl ID:
- ENSDARG00000093068
- ZFIN ID:
- ZDB-GENE-030131-2211
- Description:
- hypothetical protein LOC563665 [Source:RefSeq peptide;Acc:NP_001093483]
- Human Orthologue:
- C3
- Human Description:
- complement component 3 [Source:HGNC Symbol;Acc:1318]
- Mouse Orthologue:
- C3
- Mouse Description:
- complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]
Alleles
There are 8 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30732 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43860 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31073 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24189 | Nonsense | Available for shipment | Available now |
sa45772 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37529 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37528 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32404 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa30732
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000138595 | Nonsense | 7 | 1680 | 1 | 42 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 26827416)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 26216272 GRCz11 22 26236169 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATATTGAGTGGCGGTTACTTCAGCAGGACGATGCTTCTTCAGCTGCTGT[T/A]ATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43860
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000138595 | Nonsense | 24 | 1680 | 1 | 42 |
ENSDART00000138595 | Nonsense | 24 | 1680 | 1 | 42 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 26827366)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 26216222 GRCz11 22 26236119 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAA[C/T]GACAGTGCGTTTAACTCTGCATTATTAACTTTTAATGTGTAAAAATATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31073
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000138595 | Nonsense | 24 | 1680 | 1 | 42 |
ENSDART00000138595 | Nonsense | 24 | 1680 | 1 | 42 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 26827366)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 26216222 GRCz11 22 26236119 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAA[C/T]GACAGTGCGTTTAACTCTGCATTATTAACTTTTAATGTGTAAAAATATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24189
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000138595 | Nonsense | 158 | 1680 | 5 | 42 |
- Genomic Location (Zv9):
- Chromosome 22 (position 26821515)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 26210371 GRCz11 22 26230268 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTCGTTCCGCTCCGGACACATCTTCATTCAGACCGACAAACCTATTTA[C/A]AACCCTGGAGACAAAGGTCAGCTCTCACATGCTGCTATTGAGCTGTTTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45772
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000138595 | Nonsense | 1191 | 1680 | 29 | 42 |
- Genomic Location (Zv9):
- Chromosome 22 (position 26788626)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 26177482 GRCz11 22 26197379 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTACTTGTATTTTTTTCTCCACAGGATAAGTCTAGACAGGCAGCAGGGTA[T/A]CTGACAGAGCATTTCTCCCGGCTGACCAGGCCATATACAGCAGCTATAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37529
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000138595 | Nonsense | 1224 | 1680 | 29 | 42 |
- Genomic Location (Zv9):
- Chromosome 22 (position 26788528)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 26177384 GRCz11 22 26197281 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCATGCTATGCGCTAGCCGTATCGAACAACGCCTGCGTGAAGAGCATGT[T/A]GCTCAAATTTGCCTCACCTGGTACTTACATTTTAAACGCACAAATATGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37528
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000138595 | Nonsense | 1270 | 1680 | 30 | 42 |
- Genomic Location (Zv9):
- Chromosome 22 (position 26788309)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 26177165 GRCz11 22 26197062 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCGCTGATCAAAAGTGGCCACATGGAAGAGGCAGAAGCTCCATTTCGATG[G/A]TTGAATGAGCACCGTGGCATTGGTGGAGGATACGGCTCTACTCAGGTGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32404
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000138595 | Nonsense | 1364 | 1680 | 33 | 42 |
- Genomic Location (Zv9):
- Chromosome 22 (position 26779319)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 26168175 GRCz11 22 26188072 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTAGATGTAATTCATCGTTTATGTGTAATAGGTAGTGACGGTTTACCAT[C/T]AGCTTCCTGATGTGTATGAGAACAGCACATGCAACGGCTTTCAGCTGGAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Age-related macular degeneration: Common variants near FRK/COL10A1 and VEGFA are associated with advanced age-related macular degeneration. (View Study)
- Age-related macular degeneration: Genetic variants near TIMP3 and high-density lipoprotein-associated loci influence susceptibility to age-related macular degeneration. (View Study)
- Age-related macular degeneration: Genome-wide association identifies SKIV2L and MYRIP as protective factors for age-related macular degeneration. (View Study)
- Age-related macular degeneration: Genome-wide association study of advanced age-related macular degeneration identifies a role of the hepatic lipase gene (LIPC). (View Study)
- Age-related macular degeneration (GA): Heritability and genome-wide association study to assess genetic differences between advanced age-related macular degeneration subtypes. (View Study)
- Complement C3 and C4 levels: Genome-wide association study for serum complement C3 and C4 levels in healthy Chinese subjects. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: