acy3.1

Ensembl ID:
ENSDARG00000093003
ZFIN ID:
ZDB-GENE-040718-345
Description:
Aspartoacylase-2A [Source:UniProtKB/Swiss-Prot;Acc:Q6DHI0]
Human Orthologue:
ACY3
Human Description:
aspartoacylase (aminocyclase) 3 [Source:HGNC Symbol;Acc:24104]
Mouse Orthologue:
Acy3
Mouse Description:
aspartoacylase (aminoacylase) 3 Gene [Source:MGI Symbol;Acc:MGI:1918920]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32774 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052907 Nonsense 311 328 7 7

The following transcripts of ENSDARG00000093003 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 52994442)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51865041
GRCz11 1 52499779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCAATGAGGGTGCCTACTATGAAAAGGGAATCGCTTTTCATCTGGCC[A/T]AAAAATGGACACTGACAGTTCCATCAGTACAAGTGCAGACAACAAACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link