
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ftr26
- Ensembl ID:
- ENSDARG00000092961
- ZFIN ID:
- ZDB-GENE-070912-316
- Description:
- Novel protein with Zinc finger, C3HC4 type (RING finger) and B-box zinc finger domains [Source:UniPr
- Human Orthologue:
- TRIM65
- Human Description:
- tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
- Mouse Orthologue:
- Trim65
- Mouse Description:
- tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19877 | Nonsense | Available for shipment | Available now |
sa19878 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19877
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000140555 | Nonsense | 135 | 358 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 2 (position 48050324)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 48081988 GRCz11 2 47936152 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTCTTACTGTGAAACCCATTTTGAATGTCATGAAGTCTTTCATTCAAGT[A/T]AGCGTCATAAAGTGACCGATGCCACCGGACGAATCCAGGAGATGATCTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19878
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000140555 | Essential Splice Site | 194 | 358 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 2 (position 48050505)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 48082169 GRCz11 2 47936333 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAAAATCATGACACTGTTTCAGCTGAAGCAGAGAGAGCTGAGAAACAGG[T/A]ATGAATGCTAAAGACTTAACTTAGTTTATCTTAAATTATGTACACACATG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- White matter hyperintensity burden: Genome-wide association studies of cerebral white matter lesion burden: the CHARGE consortium. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: