si:dkey-32e6.3

Ensembl ID:
ENSDARG00000092934
ZFIN ID:
ZDB-GENE-081104-408
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B7ZDB0]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa681 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142256 Nonsense 14 369 1 5
Genomic Location (Zv9):
Chromosome 23 (position 20431456)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20216563
GRCz11 23 20142906
KASP Assay ID:
554-0589.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGAACACCATGTATAACTCTGAGAGGCTCCCTGAAACCAGTATCGAT[C/T]AAAACCAAAGCAATGGATTCAAAAGTGACGTGACGGGGCAACACAAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link