zgc:171977

Ensembl ID:
ENSDARG00000092885
ZFIN ID:
ZDB-GENE-070822-24
Description:
hypothetical protein LOC100124621 [Source:RefSeq peptide;Acc:NP_001096117]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24449 Nonsense Available for shipment Available now
sa39438 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138576 Nonsense 470 804 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9778429)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9837313
GRCz11 24 9977699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAACTAGCAGAAGCAATCTACAAGGCAGAGGCCCAGTCTGCTTCCCAA[C/T]AACCAGCACAAGCTAGCTACCAGTTGGTGGCACAGTTGGGTGTCCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138576 Nonsense 473 804 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9778420)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9837304
GRCz11 24 9977690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGCAATCTACAAGGCAGAGGCCCAGTCTGCTTCCCAACAACCAGCA[C/T]AAGCTAGCTACCAGTTGGTGGCACAGTTGGGTGTCCAACAGCCAGCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link