
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-87h14.4
- Ensembl ID:
- ENSDARG00000092844
- ZFIN ID:
- ZDB-GENE-081104-241
- Description:
- Novel protein similar to H.sapiens CPAMD8, C3 and PZP-like, alpha-2-macroglobulin domain containing
- Human Orthologue:
- CPAMD8
- Human Description:
- C3 and PZP-like, alpha-2-macroglobulin domain containing 8 [Source:HGNC Symbol;Acc:23228]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37504 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa43829 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa43830 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa37504
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000142419 | None | 216 | None | 5 | |
ENSDART00000143592 | Essential Splice Site | 57 | 587 | None | 13 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 21582140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 21235388 GRCz11 22 21260366 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGATGCAAGGCCACACGTACAACAAATCGTTTGAAGTGCAGAAGTACGG[T/G]AAGCATTTATGTATTAATATATACTGTAAAATGTAAATAGAAGTAGAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43829
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000142419 | None | 216 | None | 5 | |
ENSDART00000143592 | Essential Splice Site | 520 | 587 | None | 13 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 21586645)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 21239893 GRCz11 22 21264871 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTCCATGGCACTGGGACATCACTAAAGATGCCCGTTTTGCTTTTACGG[T/A]GAGGACATGACTTTCTCCACTTCCCCGTATTGTTTTAAGCTCAGGCAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43830
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000142419 | None | 216 | None | 5 | |
ENSDART00000143592 | Nonsense | 564 | 587 | 12 | 13 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 21587647)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 21240895 GRCz11 22 21265873 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACCTGCGTTTCAACCACACACCTCTACCCTGGTGGCAGCTATGCACTCC[C/T]GATCTGGGACACGGTACACATGCTCACAGTGTCTGAAATTTTAAGGTTAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)
- Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: