stap2a

Ensembl ID:
ENSDARG00000092810
ZFIN ID:
ZDB-GENE-030131-5383
Description:
signal transducing adaptor family member 2 [Source:RefSeq peptide;Acc:NP_942103]
Human Orthologue:
STAP2
Human Description:
signal transducing adaptor family member 2 [Source:HGNC Symbol;Acc:30430]
Mouse Orthologue:
Stap2
Mouse Description:
signal transducing adaptor family member 2 Gene [Source:MGI Symbol;Acc:MGI:2147039]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31299 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056254 Essential Splice Site 346 363 11 11
Genomic Location (Zv9):
Chromosome 2 (position 50138303)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49833835
GRCz11 2 49568065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAATATGACAGAATATTAAATATACGACTTGAAAATTATCTTCCCATC[A/T]GGCCTCACAGACGAGCTGAAACAGAAGCTGGAGAAGAGACGGACCAGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link