si:dkey-61p9.9

Ensembl ID:
ENSDARG00000092759
ZFIN ID:
ZDB-GENE-041210-240
Description:
hypothetical protein LOC558818 [Source:RefSeq peptide;Acc:NP_001038341]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20321 Nonsense Available for shipment Available now
sa6956 Nonsense Mutation detected in F1 DNA During 2018
sa9408 Nonsense Mutation detected in F1 DNA During 2018
sa6955 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131964 Nonsense 536 603 2 2
ENSDART00000144471 Nonsense 99 731 1 9
ENSDART00000148091   None 258 None 4
Genomic Location (Zv9):
Chromosome 4 (position 61370238)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76249668
GRCz11 4 77631869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAAACCCATTTCTTGATTCCTGGAAGAAGCTGACATGGATACTGTCT[A/T]AAAGGTCTCTGTTAAAGCTTCATAAGGCTGCAGTCGAGAAGACTTTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131964   None 603 None 2
ENSDART00000144471 Nonsense 224 731 1 9
ENSDART00000148091   None 258 None 4
Genomic Location (Zv9):
Chromosome 4 (position 61369862)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76250044
GRCz11 4 77631493
KASP Assay ID:
554-5155.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCTGTCCTCTGCTCAGTGGTCGGGTCTGGWGTTTGTGCTCCTGATGT[C/A]AGAAGAGACTCAAGAGAAGTTTGAACTGCAGAAGTRCAGAAGATCTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131964   None 603 None 2
ENSDART00000144471 Nonsense 237 731 1 9
ENSDART00000148091   None 258 None 4
Genomic Location (Zv9):
Chromosome 4 (position 61369824)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76250082
GRCz11 4 77631455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCTGATGTMAGAAGAGACTCAAGAGAAGTTTGAACTGCAGAAGTRC[A/T]GAAGATCTGATGAAGCACTGATGAGACTGATGCCAGTGGTCARRAACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131964   None 603 None 2
ENSDART00000144471 Nonsense 709 731 9 9
ENSDART00000148091 Nonsense 236 258 4 4
Genomic Location (Zv9):
Chromosome 4 (position 61365104)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76254802
GRCz11 4 77626735
KASP Assay ID:
554-4346.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAKCTTCTACAACATCAGTGGAGACACAATGATCCTCATCCACTCAGTC[C/T]AGACCACATTYACTGAGCCGCTCTATCCTGGGTTTWGGGTTTATCGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link