
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ftr31
- Ensembl ID:
- ENSDARG00000092745
- ZFIN IDs:
- ZDB-GENE-050417-159, ZDB-GENE-070912-107
- Description:
- Novel protein similar to H.sapiens tripartite motif-containing [Source:UniProtKB/TrEMBL;Acc:B0S651]
- Human Orthologue:
- TRIM65
- Human Description:
- tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
- Mouse Orthologue:
- Trim65
- Mouse Description:
- tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31304 | Nonsense | Available for shipment | Available now |
sa25951 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31304
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000143980 | Nonsense | 67 | 506 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 2 (position 60056745)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 59133536 GRCz11 2 59230762 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTCTACAGCTGCCCTCAGTGCAGACAGACCTTCAGCCCCAGACCCGCTT[T/A]AGCTAAAAACACCATGCTGGCTGAGATGGTGGAGAAACTGCGGAAGAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25951
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000143980 | Essential Splice Site | 198 | 506 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 2 (position 60055535)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 59132326 GRCz11 2 59229552 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGCTCATGTTATATGAGATGTATATTGAGTGTAAAGTGTGAATCCTGCA[G/A]AGACGCCTAAAGAACATCCAGAGCAGTTTCCAGCAGAGACTCCAGGAGAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- White matter hyperintensity burden: Genome-wide association studies of cerebral white matter lesion burden: the CHARGE consortium. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: