si:dkey-40m6.8

Ensembl ID:
ENSDARG00000092744
ZFIN ID:
ZDB-GENE-100922-162

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42764 Nonsense Mutation detected in F1 DNA During 2018
sa11927 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134459   None 339 None 6
ENSDART00000147981 Nonsense 175 234 5 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34378732)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32110232
GRCz11 16 32064262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATCAGGCAGTGGTGAAGGAGCTGAGGGTCAGTGCTAGTCCTCTGGAA[C/T]AGCGGAAGTTCCTGGCAGAGTCCGAGCCATACAGGTCAGACAAACTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134459 Nonsense 267 339 4 6
ENSDART00000147981   None 234 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34392095)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32123595
GRCz11 16 32077625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCGTRACCGTGGGAGGAATGTGTCATTTTTCGATGACGTCACAGTCTA[T/A]MTTTTCGATCAGGTATGTCAAGGGTGTTTATACAAGCATCTTCAATTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link