
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-51e8.2
- Ensembl ID:
- ENSDARG00000092635
- ZFIN ID:
- ZDB-GENE-091118-125
- Human Orthologues:
- EBF1, EBF2, EBF3
- Human Descriptions:
- early B-cell factor 1 [Source:HGNC Symbol;Acc:3126]
- early B-cell factor 2 [Source:HGNC Symbol;Acc:19090]
- early B-cell factor 3 [Source:HGNC Symbol;Acc:19087]
- Mouse Orthologues:
- Ebf1, Ebf2, Ebf3
- Mouse Descriptions:
- early B-cell factor 1 Gene [Source:MGI Symbol;Acc:MGI:95275]
- early B-cell factor 2 Gene [Source:MGI Symbol;Acc:MGI:894332]
- early B-cell factor 3 Gene [Source:MGI Symbol;Acc:MGI:894289]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8686 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8686
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000140184 | Essential Splice Site | 172 | 195 | 6 | 6 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 21 (position 32938983)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 33938676 GRCz11 21 33973166 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGCACAATACTGCTTTCTTAGCTAATTTTGTTTTGTTGTTGTCCTTTTA[G/A]TCGATGCTGCGACAAAAAGAGTTGTGGAAACCGCAATGAGACACCCTCTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Systolic blood pressure: Genetic variants in novel pathways influence blood pressure and cardiovascular disease risk. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: