si:dkey-256e7.5

Ensembl ID:
ENSDARG00000092600
ZFIN ID:
ZDB-GENE-090313-282
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIF8]
Human Orthologue:
EFCAB6
Human Description:
EF-hand calcium binding domain 6 [Source:HGNC Symbol;Acc:24204]
Mouse Orthologue:
Efcab6
Mouse Description:
EF-hand calcium binding domain 6 Gene [Source:MGI Symbol;Acc:MGI:1924877]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31200 Nonsense Available for shipment Available now
sa32639 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142689 Nonsense 121 234 2 5

The following transcripts of ENSDARG00000092600 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16415028)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16980196
GRCz11 1 17673133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCAGCTTCAGAGAATCGCTCTATAAGCAGAGCTTCCCTTTCAACATA[C/A]TCCAGCATTGGGCCATGGAAGACAGATCAGACTGATCAGGTAGTGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142689 Essential Splice Site 134 234 None 5

The following transcripts of ENSDARG00000092600 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16414987)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16980155
GRCz11 1 17673092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAACATACTCCAGCATTGGGCCATGGAAGACAGATCAGACTGATCAGG[T/C]AGTGCACACATTTAACTCATGATATCTTGATAACTATATTTTAAAAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link