si:dkey-61l1.4

Ensembl ID:
ENSDARG00000092567
ZFIN ID:
ZDB-GENE-070705-483
Description:
Novel collagen protein [Source:UniProtKB/TrEMBL;Acc:A5WWD4]
Human Orthologue:
COL16A1
Human Description:
collagen, type XVI, alpha 1 [Source:HGNC Symbol;Acc:2193]
Mouse Orthologue:
Col16a1
Mouse Description:
collagen, type XVI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095396]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30617 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa1363 Nonsense Available for shipment Available now
sa10054 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143098 Missense 343 1194 19 56
ENSDART00000145848 Essential Splice Site 330 1253 None 58
Genomic Location (Zv9):
Chromosome 5 (position 30859848)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28621205
GRCz11 5 29221358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGTGAAGTGGGTCCTCAGGGAATGCTGGGAAAAGAGGGTCAGAAGG[T/A]AAGAGTTATTTATGACTTTCAGGTGGAGCAATCACAACAAAAACATTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143098 Nonsense 444 1194 26 56
ENSDART00000145848 Nonsense 430 1253 24 58
Genomic Location (Zv9):
Chromosome 5 (position 30855490)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28616847
GRCz11 5 29217000
KASP Assay ID:
554-1275.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGTAGTTGTGATTAGATTTAGAACTGTTTTCTTGCTCTCAGGGCTA[T/A]CCAGGAGCCATCGGCCTTCGTGGACCGCCAGGACACACAGGAGAAAGGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143098 Nonsense 771 1194 40 56
ENSDART00000145848 Nonsense 776 1253 39 58
ENSDART00000143098 Nonsense 771 1194 40 56
ENSDART00000145848 Nonsense 776 1253 39 58
Genomic Location (Zv9):
Chromosome 5 (position 30851277)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28612634
GRCz11 5 29212787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCAAAGGGTTTCYCAGGACAAGAGGGACCWAAAGGTGAACCAGGAARA[C/T]GAGGACCGCCWGGRCTGAAAGTGAGATTSWGAAATAAATGAGAATTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link