slc16a8

Ensembl ID:
ENSDARG00000092546
ZFIN ID:
ZDB-GENE-030131-1693
Description:
solute carrier family 16 (monocarboxylic acid transporters), member 8 [Source:RefSeq peptide;Acc:NP
Human Orthologue:
PDAP1
Human Description:
PDGFA associated protein 1 [Source:HGNC Symbol;Acc:14634]
Mouse Orthologue:
Pdap1
Mouse Description:
PDGFA associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:2448536]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11619 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066393 Nonsense 95 158 4 6
Genomic Location (Zv9):
Chromosome 12 (position 20298638)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19080482
GRCz11 12 19202356
KASP Assay ID:
2260-5283.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GMAAGAAGGTTGTGGAAATTGATGTCAATGCACCTAAAGAGCTATCGCGA[C/T]GAGAAAGGTATGCGAGATGGCATATACTTAACCTCAAASCAATGAAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link