si:dkey-80c24.5

Ensembl ID:
ENSDARG00000092501
ZFIN ID:
ZDB-GENE-061207-73
Description:
Putative novel protein [Source:UniProtKB/TrEMBL;Acc:A2CEU3]
Human Orthologue:
STK36
Human Description:
serine/threonine kinase 36 [Source:HGNC Symbol;Acc:17209]
Mouse Orthologue:
Stk36
Mouse Description:
serine/threonine kinase 36 (fused homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920831]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14236 Essential Splice Site Available for shipment Available now
sa30223 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138453 Essential Splice Site 22 271 1 6
Genomic Location (Zv9):
Chromosome 25 (position 16514746)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16061290
GRCz11 25 16157690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTGGCCAGGTGTATGTGGCATCTCACAAACGCAGTAAAAGAGTAAAG[G/A]TAGAGAACTATTTTTTAAAATTCAGTCAAMATTTTCCTCCTGATTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138453 Nonsense 244 271 5 6
Genomic Location (Zv9):
Chromosome 25 (position 16513175)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15414972
GRCz10 25 16059719
GRCz11 25 15511372
GRCz11 25 16156119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGGACCTGATTTCCCAGTGTTTGATCCGTAATCCAGCTAAACGGCTA[C/T]AGTTACACCAGGTAGAAGAGCACTGCTGGTTCAATCCAACGACCCCAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link