si:dkeyp-46h3.2

Ensembl ID:
ENSDARG00000092498
ZFIN ID:
ZDB-GENE-030131-7351
Description:
hypothetical protein LOC335411 [Source:RefSeq peptide;Acc:NP_001108359]
Human Orthologues:
C21orf63, FAM176A, FAM176B
Human Descriptions:
chromosome 21 open reading frame 63 [Source:HGNC Symbol;Acc:13239]
family with sequence similarity 176, member A [Source:HGNC Symbol;Acc:25816]
family with sequence similarity 176, member B [Source:HGNC Symbol;Acc:25558]
Mouse Orthologues:
4931408A02Rik, Fam176a, Fam176b
Mouse Descriptions:
family with sequence similarity 176, member A Gene [Source:MGI Symbol;Acc:MGI:2385247]
family with sequence similarity 176, member B Gene [Source:MGI Symbol;Acc:MGI:1922063]
RIKEN cDNA 4931408A02 gene Gene [Source:MGI Symbol;Acc:MGI:1918217]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43299 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121643 Nonsense 219 234 8 9
Genomic Location (Zv9):
Chromosome 19 (position 28072783)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28002895
GRCz11 19 27587118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTTCAGCCTCCAATGGTGTCTTCTCAGATCCGTGTTATGGCACATAC[A/T]AGTACCTGTACACTGCATACTCCTGCGTGCCTCAGTGTAAGTTAAGTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link