Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
Q5RII8_DANRE
- Ensembl ID:
- ENSDARG00000092484
- Description:
- Novel protein similar to human MDN1, midasin homolog (Yeast) (MDN1) [Source:UniProtKB/TrEMBL;Acc:Q5R
- Human Orthologue:
- MDN1
- Human Description:
- MDN1, midasin homolog (yeast) [Source:HGNC Symbol;Acc:18302]
- Mouse Orthologue:
- Mdn1
- Mouse Description:
- midasin homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1926159]
Alleles
There are 10 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa23694 | Nonsense | Available for shipment | Available now |
| sa25134 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa31044 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa43434 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa37021 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa29353 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa1349 | Nonsense | Available for shipment | Available now |
| sa8598 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa23693 | Essential Splice Site | Available for shipment | Available now |
| sa6631 | Nonsense | Confirmed mutation in F2 line | During 2018 |
Mutation Details
- Allele Name:
- sa23694
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Nonsense | 115 | 2198 | 1 | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23880795)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23999596 GRCz11 20 23898696 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCTTTATCCTGATGTGGTGGTGCCTCTGCGGGCAGCTATTTTGCAGGTG[C/T]AGCATGGGATGCGACTCCTGGCTTCTCAGGTGTCCTTTTCAACGACTGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25134
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Essential Splice Site | 668 | 2198 | None | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23875882)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23994683 GRCz11 20 23893783 - KASP Assay ID:
- 554-7375.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCTCTAATCAACTAAATGTTTTAAAAATTATACCATTCTATCTGTGGTC[A/G]GGACCCTGTTTAAGTTTGTGAAGAAGTTTGAAGCGGCACTGAAGGAGCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31044
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Essential Splice Site | 829 | 2198 | None | 38 |
| ENSDART00000143005 | Essential Splice Site | 829 | 2198 | None | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23874702)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23993503 GRCz11 20 23892603 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGAAACAGAGAGCACTGGCTGATCTCTTCAAGATGCTTGCACAGATAGG[T/C]CAGTCTGAGTTGCTTCTTCTGGTTTTAGAAACCTTGTTTAGAAATACTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43434
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Essential Splice Site | 829 | 2198 | None | 38 |
| ENSDART00000143005 | Essential Splice Site | 829 | 2198 | None | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23874702)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23993503 GRCz11 20 23892603 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGAAACAGAGAGCACTGGCTGATCTCTTCAAGATGCTTGCACAGATAGG[T/C]CAGTCTGAGTTGCTTCTTCTGGTTTTAGAAACCTTGTTTAGAAATACTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37021
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Essential Splice Site | 1085 | 2198 | None | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23872303)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23991104 GRCz11 20 23890204 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTGGATGGACTGGCGGAGGAGTCCACAGAAAGAGCTATTTGTAGTTGG[T/C]AAGACCGAATAATATTTTACACTCTGTCTGTTCAGTTATTGAGTTGTGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29353
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Nonsense | 1170 | 2198 | 19 | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23870802)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23989603 GRCz11 20 23888703 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCATTTATGTTTTTTTATAGAGAGTGACTCAGAGGTAGTGGAGGAGCTCT[T/G]AAAACCAGGACACTTGAGCAGGTTGCTGGAAGAGGAACTGAGTGGAGACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1349
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Nonsense | 1245 | 2198 | 20 | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23870485)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23989286 GRCz11 20 23888386 - KASP Assay ID:
- 554-1263.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGCGTTTGGAGCCCATGCTGTGTCTCTACTCTGAATTGGTGAGGTATTA[T/A]CTTGCTGTGCTGATGGGGGCTCACCGTACCACYGGAAAGCTTTTGTCCGT
- Associated Phenotype:
-
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037eye
ZFA:0000107decreased size
PATO:0000587abnormal
PATO:0000460Larval:Day 5
ZFS:0000037gut
ZFA:0000112quality
PATO:0000001abnormal
PATO:0000460Larval:Day 5
ZFS:0000037head
ZFA:0001114decreased size
PATO:0000587abnormal
PATO:0000460Larval:Day 5
ZFS:0000037inner ear
ZFA:0000217decreased size
PATO:0000587abnormal
PATO:0000460Larval:Day 5
ZFS:0000037melanocyte
ZFA:0009091quality
PATO:0000001abnormal
PATO:0000460Larval:Day 5
ZFS:0000037pericardium
ZFA:0000054edematous
PATO:0001450abnormal
PATO:0000460Larval:Day 5
ZFS:0000037swim bladder
ZFA:0000076aplastic
PATO:0001483abnormal
PATO:0000460Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094decreased size
PATO:0000587abnormal
PATO:0000460Larval:Day 5
ZFS:0000037yolk
ZFA:0000084increased size
PATO:0000586abnormal
PATO:0000460
- mRNA Expression Profiling Preview:
- View complete mRNA expression profile
| Region | 3' end position | 3' end strand | Adjusted p-value | Log2 fold change (mutant/sibling) | Closest Ensembl gene 3' end | Gene name | e74 Ensembl Gene ID |
|---|---|---|---|---|---|---|---|
| 20:54337471-54337800 | 54337471 | -1 | 1.18 × 10-152 | 2.2 | -3 | hsp90aa1.1 | ENSDARG00000010478 |
| 1:60218201-60218572 | 60218572 | 1 | 4.01 × 10-100 | -4.1 | -5 | cyp3a65 | ENSDARG00000045627 |
| 16:28404313-28404900 | 28404313 | -1 | 1.72 × 10-94 | 2.9 | 0 | arhgef1b | ENSDARG00000055837 |
| 22:41086023-41086500 | 41086023 | -1 | 5.48 × 10-91 | -2.8 | -4 | tm4sf4 | ENSDARG00000040747 |
| 8:21907052-21907500 | 21907052 | -1 | 8.51 × 10-82 | -8.4 | -3 | ela2l | ENSDARG00000056765 |
Mutation Details
- Allele Name:
- sa8598
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Nonsense | 1804 | 2198 | 29 | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23865043)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23983844 GRCz11 20 23882944 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGATGARGAAGATGAYATYGCGATGGAAGTGGARGAAGAGAAGGAYCTA[C/T]AAGCAGTTGAAGCCCAGGAGCTTAAACCAGAGAAGCTAAATGACAATAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23693
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Essential Splice Site | 1908 | 2198 | None | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23863658)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23982459 GRCz11 20 23881559 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTGCTTAAATGTGTGTGTATTTATTTGTGTGTTTTGCTGTTGTCCCTC[A/C]GGAGAGTGCTGCTGCAGCGTTGTGGCATCAGTACCAGACCCTGACATCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6631
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000143005 | Nonsense | 1974 | 2198 | 33 | 38 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 23862978)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23981779 GRCz11 20 23880879 - KASP Assay ID:
- 554-4560.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCGGAAAGTTATTCCCTACATTGCCAGTCAGTTCCGCAAGGATAAGATCT[G/A]GCTGAGGAGAACAAAACCCAGCAAGAGGAAYTACCAGATCTGCCTGGCTG
- Associated Phenotype:
-
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037eye
ZFA:0000107decreased size
PATO:0000587abnormal
PATO:0000460Larval:Day 5
ZFS:0000037gut
ZFA:0000112quality
PATO:0000001abnormal
PATO:0000460Larval:Day 5
ZFS:0000037head
ZFA:0001114decreased size
PATO:0000587abnormal
PATO:0000460Larval:Day 5
ZFS:0000037inner ear
ZFA:0000217decreased size
PATO:0000587abnormal
PATO:0000460Larval:Day 5
ZFS:0000037melanocyte
ZFA:0009091quality
PATO:0000001abnormal
PATO:0000460Larval:Day 5
ZFS:0000037pericardium
ZFA:0000054edematous
PATO:0001450abnormal
PATO:0000460Larval:Day 5
ZFS:0000037swim bladder
ZFA:0000076aplastic
PATO:0001483abnormal
PATO:0000460Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094decreased size
PATO:0000587abnormal
PATO:0000460Larval:Day 5
ZFS:0000037yolk
ZFA:0000084increased size
PATO:0000586abnormal
PATO:0000460
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
