
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
B0V1S6_DANRE
- Ensembl ID:
- ENSDARG00000092420
- Description:
- Novel protein similar to vertebrate plexin B family [Source:UniProtKB/TrEMBL;Acc:B0V1S6]
- Human Orthologue:
- PLXNB3
- Human Description:
- plexin B3 [Source:HGNC Symbol;Acc:9105]
- Mouse Orthologue:
- Plxnb3
- Mouse Description:
- plexin B3 Gene [Source:MGI Symbol;Acc:MGI:2154240]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6093 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa34299 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21199 | Nonsense | Available for shipment | Available now |
sa13997 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa6093
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000147940 | Essential Splice Site | None | 660 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 8 (position 8740902)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 8157484 GRCz11 8 8196069 - KASP Assay ID:
- 554-3725.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTTTTCAACCTNCCCCTCTTTCTTTCTTCTTGATCCCTATCTCTYTTTC[A/C]GCAGGTGAGGGGGTGCCATGCCAGCTGCTGCTCCCCTGTTGCTGCTCCTY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34299
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000147940 | Nonsense | 197 | 660 | 2 | 9 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 8741508)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 8158090 GRCz11 8 8196675 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCGGGGCTACACCAGTAAAGGACCTGGTGGGATCCCACCAATCACAATG[C/T]GACGTTTAACCCCAGTTGAGCGACATTCTGCACCGGCGTTCTCCCATGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21199
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000147940 | Nonsense | 308 | 660 | 2 | 9 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 8741841)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 8158423 GRCz11 8 8197008 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGGCTTTCACCGGGAGCAACCTGCGCTGTTTGTGGCTATGGCCATGGGA[C/T]AAGCATCAACTCCTACACCCACAGACAAGTCGGCTCTTTGTGTGTACACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13997
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000147940 | Essential Splice Site | 471 | 660 | 4 | 9 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 8760486)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 8177068 GRCz11 8 8215653 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACTGCTGGAYGCCACCAAACAGAACRTCTTCGTATTGACYGAAAGAAAG[G/A]TAYTGGAGACAAACTGCTTCCTTTTATCTGSCRTCAAGTGAAACAAACAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: