vtg7

Ensembl ID:
ENSDARG00000092419
ZFIN ID:
ZDB-GENE-001201-6
Description:
vitellogenin 7 [Source:RefSeq peptide;Acc:NP_001096141]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37524 Nonsense Mutation detected in F1 DNA During 2018
sa29795 Nonsense Mutation detected in F1 DNA During 2018
sa24183 Nonsense Available for shipment Available now
sa39376 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9666 Nonsense Available for shipment Available now
sa24182 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078216 Nonsense 49 1358 3 28
ENSDART00000137998   None 213 None 7
ENSDART00000138378 Nonsense 49 1343 3 27

The following transcripts of ENSDARG00000092419 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25330101)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24830007
GRCz11 22 24857631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGTATGAGGCTCTGCTCCTGGGTGGTCTTCCTCAAGAAGGTCTGGCC[A/T]GAGCAGGTATCAAAGTCAGCAGCAAGGTTCTCCTCAGTGCCATGACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078216 Nonsense 245 1358 6 28
ENSDART00000137998 Nonsense 41 213 4 7
ENSDART00000138378 Nonsense 245 1343 6 27

The following transcripts of ENSDARG00000092419 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25329235)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24829141
GRCz11 22 24856765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGGTGCACTGATCGCTGAGGCAACAGTTGAGGAAGTGTATCAGTTCT[C/A]ACCCTTCAATGAGATCCATGGTGCTGCAATGATGGAAGCAAAGTATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078216 Nonsense 783 1358 17 28
ENSDART00000137998   None 213 None 7
ENSDART00000138378 Nonsense 783 1343 17 27

The following transcripts of ENSDARG00000092419 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25326512)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24826418
GRCz11 22 24854042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCTTAAAGCTTTGCAGGAAGGAGTTGCCTTCCAGTATGCCAAACCTT[T/A]GCTTGCAGCTGAAGTGCGTCGTATCTTGCCAACTGCAGTTGGTGTGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078216 Essential Splice Site 816 1358 17 28
ENSDART00000137998   None 213 None 7
ENSDART00000138378 Essential Splice Site 816 1343 17 27

The following transcripts of ENSDARG00000092419 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25326412)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24826318
GRCz11 22 24853942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGTTCAGTTTGTACACTGCTGCTGTTGCTGCTGCATCTGTCAATGG[T/C]AAATTTTTGCCTCAGAATTTCTATATCCTTTATTCAGATATGGGGGGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078216 Nonsense 903 1358 19 28
ENSDART00000137998   None 213 None 7
ENSDART00000138378 Nonsense 903 1343 19 27

The following transcripts of ENSDARG00000092419 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25325972)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24825878
GRCz11 22 24853502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGAGCAGACATTCTCAAGGGCAACTACAAGGTGGAGACTCTGCCTGTT[G/T]AACTTCCTGAACACATTGCTTCAGCAAGGTAATGACATTTCTGTAMACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078216 Nonsense 1177 1358 25 28
ENSDART00000137998   None 213 None 7
ENSDART00000138378 Nonsense 1162 1343 24 27

The following transcripts of ENSDARG00000092419 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25324600)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24824506
GRCz11 22 24852130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCTTCCACCTGTTTTTGCTATCATCGCCCGTGCTGTTAGAGATGAC[C/T]AGAAGCTTCTGGGCTACCAACTGGCTGCTTACTTTGACAAACCAACTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link