si:dkey-79p17.3

Ensembl ID:
ENSDARG00000092404
ZFIN ID:
ZDB-GENE-081105-132
Description:
Novel protein similar to vertebrate lactase (LCT) [Source:UniProtKB/TrEMBL;Acc:B0UYB9]
Human Orthologue:
LCT
Human Description:
lactase [Source:HGNC Symbol;Acc:6530]
Mouse Orthologue:
Lct
Mouse Description:
lactase Gene [Source:MGI Symbol;Acc:MGI:104576]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38764 Nonsense Mutation detected in F1 DNA During 2018
sa27482 Nonsense Mutation detected in F1 DNA During 2018
sa38763 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145110 Nonsense 298 1592 2 12
ENSDART00000145931 Nonsense 604 1898 7 17
Genomic Location (Zv9):
Chromosome 9 (position 47594313)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46593116
GRCz11 9 46393595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTCATGCTGGGGTGGTTTGCTCATCCAATATTTGTAGATGGAGATTA[T/A]CCAGCGGTACTGAGGGAGCAAATTGAGAAAAAGAAAGAATTGTGTACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145110 Nonsense 710 1592 3 12
ENSDART00000145931 Nonsense 1016 1898 8 17
Genomic Location (Zv9):
Chromosome 9 (position 47592942)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46591745
GRCz11 9 46392224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGTTAGCATATTCAATGAATATTGTGACTTCTGCTATGCAACATTT[G/T]GAGATAGGGTGAAGTTTTGGATCACCTTTAATGAACCCCAGACGATTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145110 Essential Splice Site 1361 1592 10 12
ENSDART00000145931 Essential Splice Site 1667 1898 15 17
Genomic Location (Zv9):
Chromosome 9 (position 47590427)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46589230
GRCz11 9 46389709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTTTCTGAATTCAAGCATCAGGATTCAAAAAGTTGCCATTTATTCC[A/T]GGGGTGCTGGAGCTATTAGGGATCGTACATGGCTAGATTCTGGATCCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link