
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
taar20d1
- Ensembl ID:
- ENSDARG00000092399
- ZFIN ID:
- ZDB-GENE-091116-90
- Human Orthologues:
- TAAR5, TAAR6, TAAR8
- Human Descriptions:
- trace amine associated receptor 5 [Source:HGNC Symbol;Acc:30236]
- trace amine associated receptor 6 [Source:HGNC Symbol;Acc:20978]
- trace amine associated receptor 8 [Source:HGNC Symbol;Acc:14964]
- Mouse Orthologues:
- Taar5, Taar6, Taar7a, Taar7b, Taar7d, Taar7e, Taar7f, Taar8a, Taar8b, Taar8c, Taar9
- Mouse Descriptions:
- trace amine-associated receptor 5 Gene [Source:MGI Symbol;Acc:MGI:2685073]
- trace amine-associated receptor 6 Gene [Source:MGI Symbol;Acc:MGI:2685074]
- trace amine-associated receptor 7A Gene [Source:MGI Symbol;Acc:MGI:2685075]
- trace amine-associated receptor 7B Gene [Source:MGI Symbol;Acc:MGI:3527438]
- trace amine-associated receptor 7D Gene [Source:MGI Symbol;Acc:MGI:3527443]
- trace amine-associated receptor 7E Gene [Source:MGI Symbol;Acc:MGI:3527445]
- trace amine-associated receptor 7F Gene [Source:MGI Symbol;Acc:MGI:3527447]
- trace amine-associated receptor 8A Gene [Source:MGI Symbol;Acc:MGI:2685076]
- trace amine-associated receptor 8B Gene [Source:MGI Symbol;Acc:MGI:2685995]
- trace amine-associated receptor 8C Gene [Source:MGI Symbol;Acc:MGI:3527452]
- trace amine-associated receptor 9 Gene [Source:MGI Symbol;Acc:MGI:3527454]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41721 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41721
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000136741 | Nonsense | 316 | 328 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 10 (position 41845071)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 40557780 GRCz11 10 40478966 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTAACTCAGGTCTGAATCCTCTGATTTATGCTTTATTTTACCCCTGGTTT[A/T]AAAAGTCAGCTAAACTCATTTTAACTCTGAAAATATTCAATCAGCATCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: