si:dkey-6e12.4

Ensembl ID:
ENSDARG00000092392
ZFIN ID:
ZDB-GENE-030131-7683
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPL6]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23305 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135350 Nonsense 59 475 2 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 22157305)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22387528
GRCz11 18 22376594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGACCTTGTATTCGTTTGTGTCTGTAAAGGAGCAGGCCGCAGAGATC[G/T]AGAATGAGGCCAATGAGAACATGGGGAGGGTTGATGAAGGTGTAGAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link