si:dkey-28d5.3

Ensembl ID:
ENSDARG00000092384
ZFIN ID:
ZDB-GENE-060503-919

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25350 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139960 Essential Splice Site 258 377 4 5
ENSDART00000145552   None 256 None 3
Genomic Location (Zv9):
Chromosome 7 (position 4950668)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4640981
GRCz11 7 4779007
KASP Assay ID:
554-7630.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGACTACTTTAGTCCTTACCATCAGTATCCTTTTATATGTCATGAAGG[T/C]GAGCAGATCCTCCAAACACACTCAATCCATCATCAGCTCCAGATCTCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link