zgc:63774

Ensembl ID:
ENSDARG00000092367
ZFIN ID:
ZDB-GENE-030131-2552
Description:
riboflavin transporter 1 [Source:RefSeq peptide;Acc:NP_955950]
Human Orthologues:
GPR172A, GPR172B
Human Descriptions:
G protein-coupled receptor 172A [Source:HGNC Symbol;Acc:30224]
G protein-coupled receptor 172B [Source:HGNC Symbol;Acc:30225]
Mouse Orthologue:
Gpr172b
Mouse Description:
G protein-coupled receptor 172B Gene [Source:MGI Symbol;Acc:MGI:1289288]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36828 Nonsense Mutation detected in F1 DNA During 2018
sa15210 Nonsense Available for shipment Available now
sa36827 Nonsense Mutation detected in F1 DNA During 2018
sa23509 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045675 Nonsense 30 418 3 5
Genomic Location (Zv9):
Chromosome 19 (position 22822806)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22754186
GRCz11 19 22338509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAACTTTAAAACATGTTCTTTCTTTACAGGATGGAATTTGCCTGCCTA[T/A]ATTTCAGTTCTGATTGCGTTTGGGAATTTGGGACCAGTGGTTGTCACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045675 Nonsense 114 418 3 5
Genomic Location (Zv9):
Chromosome 19 (position 22822555)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22753935
GRCz11 19 22338258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTACTTTTATACTGTCATTATTCTGCTGCACTTCCAATGTYACCTTCT[T/G]ACCCTTTATGTATCGGTACCCTCCACAATATATCCGGACGTTCTTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045675 Nonsense 235 418 3 5
Genomic Location (Zv9):
Chromosome 19 (position 22822193)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22753573
GRCz11 19 22337896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCCATCCTTTACAAAATGGAGATTCTCCAGTTTCTGAGGAGCAAGTC[G/T]AAGTTGAAAAACAGGCTCCCGTTGTGGCCTTCTGGACATCTCGCAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045675 Essential Splice Site 349 418 4 5
Genomic Location (Zv9):
Chromosome 19 (position 22820223)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22751603
GRCz11 19 22335926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCCCTGTCCACCACTTTTAGGAAGCCAGTTTGGAGTTGCTCTAGTGG[T/G]TAGTAAATGGGTTTTATTAATGAGTGGGAGAGGAACTTACTCAGAACGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link