tlr20f

Ensembl ID:
ENSDARG00000092355
ZFIN ID:
ZDB-GENE-040220-7
Description:
Toll-like receptor 20f [Source:UniProtKB/TrEMBL;Acc:Q6TQG9]
Mouse Orthologues:
Tlr11, Tlr12
Mouse Descriptions:
toll-like receptor 11 Gene [Source:MGI Symbol;Acc:MGI:3045226]
toll-like receptor 12 Gene [Source:MGI Symbol;Acc:MGI:3045221]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27420 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134799 Nonsense 101 176 1 1
Genomic Location (Zv9):
Chromosome 9 (position 31239819)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30395765
GRCz11 9 30206511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGCCGTACTCTTTGTCTCGTCAGTCAAAACTACCTCGGTAGCAACTG[G/A]TGCTCACTTGAGATGCAGCTGGCCACCTACCGGCTTCAGGTAGAACACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link